cuSBF
Loading...
Searching...
No Matches
cuSBF

Documentation

Overview

cuSBF is a high-performance GPU implementation of the Super Bloom filter, optimized for high-throughput batch k-mer insertion and query on nucleotide (DNA) and protein sequences (or any other sequence type as long as a valid alphabet is provided).

It exploits the streaming nature of sequence-derived k-mers by using minimizers to group consecutive k-mers sharing the same minimiser into super-k-mers, assigning all k-mers of a super-k-mer to the same 256-bit memory shard. This amortizes random memory accesses across consecutive k-mer queries, reducing memory-bandwidth pressure. The findere scheme further reduces false positives dramatically by inserting overlapping s-mers and requiring a full run of consecutive s-mer matches.

Features

  • CUDA-accelerated batch k-mer insert and query from sequences
  • Configurable k-mer length, minimiser width, s-mer width, and hash function count
  • Minimizer-based shard selection for cache-efficient streaming queries
  • Findere false-positive reduction via overlapping s-mer membership
  • Header-only library design
  • FASTA/FASTQ stream and file support

Performance

Benchmarks (Config<31, 28, 16, 4>) comparing cuSBF against NVIDIA's cuco bloom_filter on an NVIDIA RTX PRO 6000 Blackwell GPU with random DNA sequence inputs. Throughput is reported in billions of k-mers per second (Gk-mers/s). Timings include GPU-side sequence encoding for cuco, so both methods consume the same input sequence.

Dataset Size Operation cuSBF cuco Bloom Speed-up
~4M k-mers Insert 62.9 Gk-mers/s 31.5 Gk-mers/s 2.0×
~4M k-mers Query 109 Gk-mers/s 44.2 Gk-mers/s 2.5×
~268M k-mers Insert 46.6 Gk-mers/s 5.9 Gk-mers/s 7.9×
~268M k-mers Query 101 Gk-mers/s 13.2 Gk-mers/s 7.7×

The findere scheme (s-mer width) provides strong false-positive reduction at equivalent memory. For Config<31, 28, 16, 4> on ~4.6M inserted k-mers queried against 10⁹ random k-mers:

Bits/k-mer cuSBF FPR cuco Bloom FPR
58 0.0035% 0.064%
116 0.00036% 0.017%
231 0.000092% 0.0054%

Benchmarks can be reproduced with:

./build/benchmarks/gpu-filter-comparison --benchmark_filter="CuSBF"
./build/benchmarks/fpr-fastx-sweep

Requirements

  • CUDA Toolkit >= 13.1
  • C++20 compatible host compiler
  • Meson build system
  • NVIDIA GPU with compute capability 8.0+ (Ampere, Lovelace, Hopper, Blackwell)

Building

meson setup build
ninja -C build

Benchmarks and tests are built automatically when this is a standalone project, but skipped when used as a subproject. Control with Meson feature options:

Option Behaviour
-Dbenchmarks=auto (default) Build benchmarks when standalone, skip when subproject
-Dbenchmarks=enabled Always build benchmarks
-Dbenchmarks=disabled Never build benchmarks
-Dtests=auto (default) Build tests when standalone, skip when subproject
-Dtests=enabled Always build tests
-Dtests=disabled Never build tests
-Dexamples=auto (default) Build examples when standalone, skip when subproject
-Dexamples=enabled Always build examples
-Dexamples=disabled Never build examples
-Dparam_sweep=disabled (default) Never build parameter-sweep benchmark (s, m) for DNA or protein
-Dparam_sweep=enabled Build parameter-sweep benchmark (s, m) for DNA or protein
-Dparam_sweep_alphabet=dna Alphabet for param_sweep: dna or protein

‍[!IMPORTANT] The parameter sweep is disabled by default for a reason, there are 208 binaries for the entire sweep when using the DNA alphabet.

Examples:

# Standalone: build everything except parameter sweep (default)
meson setup build
# Standalone: skip benchmarks and tests
meson setup build -Dbenchmarks=disabled -Dtests=disabled
# Subproject: force benchmarks and tests on
meson setup build -Dbenchmarks=enabled -Dtests=enabled
# Parameter-sweep benchmark (DNA, default)
meson setup build -Dparam_sweep=enabled
# Parameter-sweep benchmark (protein)
meson setup build -Dparam_sweep=enabled -Dparam_sweep_alphabet=protein

Usage

// Configure the filter: k-mer length, s-mer width, minimizer width, hash count
// Create a filter with the desired capacity (in bits)
cusbf::Filter<Config> filter(1 << 24); // ~16M bits
// Insert k-mers from a DNA sequence (synchronous)
filter.insertSequence("ACGTACGTACGTACGTACGTACGTACGTACGT");
// Query k-mers (returns vector<uint8_t>, 1 = present, 0 = absent)
auto hits = filter.containsSequence("ACGTACGTACGTACGTACGTACGTACGTACGT");
// Device-resident API (async, no synchronization)
thrust::device_vector<char> d_seq = ...;
thrust::device_vector<uint8_t> d_results(numKmers);
filter.insertSequenceDevice(cusbf::device_span<const char>(d_seq));
filter.containsSequenceDevice(
);
// Dense record batch API: one concatenated payload plus explicit record ranges.
std::string batchSequence = "ACGTACGTTGCATGCA";
std::vector<cusbf::RecordRange> batchRanges{
{0, 8},
{8, 8},
};
auto batchSummary = filter.queryRecordBatch(
{
batchSequence,
cuda::std::span<const cusbf::RecordRange>{batchRanges.data(), batchRanges.size()},
},
[](const cusbf::RecordQueryView& record) {
// record.sequence is the original record, record.hits is one bool per k-mer
}
);
// FASTA/FASTQ file insertion and aggregate query (chunked internally for large inputs)
filter.insertFastxFile("reference.fasta");
auto summary = filter.queryFastxFile("queries.fastq");
// Streaming FASTX query emits each record as soon as its chunk completes
auto streamed = filter.queryFastxFileRecords(
"queries.fastq",
[](const cusbf::FastxRecordView& record) {
// record.header, record.sequence, record.queriedKmers, record.hits
}
);
// Detailed FASTX query keeps owning per-record copies in source order
auto detailed = filter.queryFastxFileDetailed("queries.fastq");
// Inspect filter state
double load = filter.loadFactor(); // fraction of set bits
uint64_t bits = filter.filterBits();
cuSBF GPU-accelerated sectorized Bloom filter.
Compile-time configuration for a cusbf::Filter.
A span that is assumed to point to device-accessible memory.

Configuration Options

The Config template accepts the following parameters:

Parameter Description Default
K k-mer length (max depends on alphabet) -
S s-mer width for findere Bloom hash seed (1-K) -
M Minimiser width for shard selection (1-K) -
HashCount Number of independent Bloom hash functions (1-16) 4
CudaBlockSize CUDA threads per block 256
Alphabet Symbol encoding (DNA or protein) DnaAlphabet

Protein Alphabet Support

filter.insertSequence("ACDEFGHIKLMNPQRSTVWY");
auto hits = filter.containsSequence("ACDEFGHIKLMNPQRSTVWY");

Related Publications

  • E. Conchon-Kerjan, T. Rouzé, L. Robidou, F. Ingels, and A. Limasset, “Super Bloom: Fast and precise filter for streaming k-mer queries,” bioRxiv, 2026, doi: 10.64898/2026.03.17.712354.
  • D. Jünger, K. Kristensen, Y. Wang, X. Yu, and B. Schmidt, “Optimizing Bloom Filters for Modern GPU Architectures.” 2025. [Online]. Available: https://arxiv.org/abs/2512.15595